Evaluation of the capability of PCR method for detection of campylocater jejuni in meat products
Evaluation of the capability of PCR method for detection of campylocater jejuni in meat products
چکیده
Introduction: campylobacter coli and c.jejuni are known to be the most prevalent cause of gastroenteritis in human. on the other hand, detection is problematic due to microaerophilic nature of the bacteria.
Objective:The objective of present thesis is to evaluate the capability of PCR method as alternative to conventional method in detection of C. jejuni
Methods: Phonotypical confirmation of C.jejuni was achieved by culturing in campylobacter selective agar base medium, gram staining, and oxidase and catalase tests. Primers of forward: ACTTCGTGCAGATATGGATGCTT and reverse: GCACCACCCAAACCCTCTTC specific for C.jejuni based on hipO gene were. LOD50 determination was performed by culturing serial dilution of pure bacteria incolum as well as meat inoculated test samples in Bolton broth in quadruple followed by the conventional culture method and PCR detection methods separately. The first two dilutions of four with sign of growth or band of 812 bps in gel electrophoresis was considered as LOD50 .
Results: C.jejuni detection was confirmed in Campylobacter Selective Agar Base by producing gray colonies followed by purple dye in oxidase test and bubbles in catalase test. PCR results were showed an 812 pbs band in gel electrophoresis indicating the replication of hipO gene by designed primers. LOD50 was obtained to be 37 CFU for both culture and molecular methods.
Conclusion: comparison of LOD50 of two methods indicated that PCR method can be used as an alternative for conventional culture method.