Detection of clostridium in herbal products with PCR method
Abstract
Introduction: According to world health organization (WHO) guidelines, because of the pathogenic properties of clostridium strains, these bacteria must not be present in herbal pharmaceutical products.
Objective: The objective of the study was to evaluate the clostridium contamination level in Thymus and Descurainia Sophia collected from Tabriz city perfumeries with WHO standards and polymerase chain reaction (PCR) methods.
Methods: Phonotypical confirmation of clostridium was achieved following culturing in SPS agar, cooked meat and TSC media as well as gram staining. PCR was designed using specific primers (forward: CACAGYAGGTTGCAAAACTAATG and reverse: GCTGTTCCTTTTTGAGAGTTAGC) for clostridium strain. For LOD50 determination, serial dilution of pure bacteria as well as herbal matrix contaminated with pure bacteria were prepared and each dilution was cultured in cooked meat medium in triplicate. Then, the cultured bacteria were transferred to the specific clostridium medium and after DNA extraction and PCR, the results were compared with LOD50 values.
Results: Clostridium produces an organic burn smell and does nor digest the meat. clostridium perfringens formed giant, round, semi-clear convex with the smooth edges in 5% defibrinated sheep agar causing dual hemolysis. Moreover, central oval spores and Swollen bacillus in terminal region were also formed. PCR was also performed for this gene with specific primers and a 204bp bond was observed. LOD50 for both direct culture and molecular methods was also evaluated as 11CFU.
Conclusion: LOD50 comparison in two methods indicated that PCR can be used as an alternative method instead of conventional culture.